86
|
Changzhou Smart-Lifesciences Biotechnology Co Ltd
resource source identifier anti gfp magnetic agarose beads smart lifesciences cat Resource Source Identifier Anti Gfp Magnetic Agarose Beads Smart Lifesciences Cat, supplied by Changzhou Smart-Lifesciences Biotechnology Co Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/RESOURCE+SOURCE+IDENTIFIER+anti+GFP+magnetic+agarose+beads+Smart+Lifesciences+Cat+SM038001/pm41904950-237-2-9 Average 86 stars, based on 1 article reviews
resource source identifier anti gfp magnetic agarose beads smart lifesciences cat - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
flag peptide dykddddk Flag Peptide Dykddddk, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/flag++dykddddk++peptide/pmc08908544__mmc2-229-54-58 Average 90 stars, based on 1 article reviews
flag peptide dykddddk - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
98
|
Addgene inc
tggaatcctgaacccacttct plasmids pspax2 addgene Tggaatcctgaacccacttct Plasmids Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/psPAX2+(Plasmid+%2312260)/pm41411133-276-150-153 Average 98 stars, based on 1 article reviews
tggaatcctgaacccacttct plasmids pspax2 addgene - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
92
|
Addgene inc
recombinant dna psicor ef1a mch puro salomonis Recombinant Dna Psicor Ef1a Mch Puro Salomonis, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/pSicoR-Ef1a-mCh-Puro+(Plasmid+%2331845)/pm34496239-399-232-248 Average 92 stars, based on 1 article reviews
recombinant dna psicor ef1a mch puro salomonis - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
86
|
Panlab
smart video tracking system panlab Smart Video Tracking System Panlab, supplied by Panlab, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/system+tracking+video/pm35235793-232-185-189 Average 86 stars, based on 1 article reviews
smart video tracking system panlab - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Panlab
fear combined system panlab Fear Combined System Panlab, supplied by Panlab, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/startle/pm35235793-232-176-179 Average 86 stars, based on 1 article reviews
fear combined system panlab - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
95
|
Qiagen
assays qiagen plasmid mini kit Assays Qiagen Plasmid Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/QIAGEN+Plasmid+Mini+Kit/pm39317197-595-115-116 Average 95 stars, based on 1 article reviews
assays qiagen plasmid mini kit - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
90
|
EASY BIO Inc
anti-actin Anti Actin, supplied by EASY BIO Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/anti+actin+antibody/pm39317197-595-9-10 Average 90 stars, based on 1 article reviews
anti-actin - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Obio Technology Corp Ltd
akd001 pakd cmv bglobin egfp h1 shrna obio technology Akd001 Pakd Cmv Bglobin Egfp H1 Shrna Obio Technology, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/akd001+bglobin+cmv+egfp+h1+obio+pakd+shrna+technology/pm35235793-232-65-67 Average 86 stars, based on 1 article reviews
akd001 pakd cmv bglobin egfp h1 shrna obio technology - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
99
|
Oxford Instruments
imaris bitplane Imaris Bitplane, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/Imaris/pm32610125-346-182-182 Average 99 stars, based on 1 article reviews
imaris bitplane - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
90
|
Promega
pgl3-basic Pgl3 Basic, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/pgl3+basic/pm30695697-298-207-209 Average 90 stars, based on 1 article reviews
pgl3-basic - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
99
|
Cell Signaling Technology Inc
e7330s simplechip enzymatic chromatin ip kit cell signaling E7330s Simplechip Enzymatic Chromatin Ip Kit Cell Signaling, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paper+n+a+smart+primer/SimpleChIP+Enzymatic+Chromatin+IP+Kit/pm28292424-224-181-187 Average 99 stars, based on 1 article reviews
e7330s simplechip enzymatic chromatin ip kit cell signaling - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |